FGG ORF clone

Description: The protein encoded by this gene is the gamma component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia and thrombophilia. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015].

This ORF sequence encodes a protein that is exactly the same as the protein of NM_000509. The protein has 7 functional sites and/or regions.

Product Details

Clone Vector	pCT-AAV-CMV-MCS vector
Species	Human
Promotor for Target Gene	CMV
Target Gene Name	FGG
Target Gene Position	Inserted between PacI and AscI
ORF Length	1314
Protein Length	437
Native Stop Codon	True
ORF Sequence	atgagttggtccttgcacccccggaatttaattctctacttctatgctcttttatttctctcttcaacatgtgtagcatatgttgctaccagagacaactgctgcatcttagatgaaagattcggtagttattgtccaactacctgtggcattgcagatttcctgtctacttatcaaaccaaagtagacaaggatctacagtctttggaagacatcttacatcaagttgaaaacaaaacatcagaagtcaaacagctgataaaagcaatccaactcacttataatcctgatgaatcatcaaaaccaaatatgatagacgctgctactttgaagtccaggaaaatgttagaagaaattatgaaatatgaagcatcgattttaacacatgactcaagtattcgatatttgcaggaaatatataattcaaataatcaaaagattgttaacctgaaagagaaggtagcccagcttgaagcacagtgccaggaaccttgcaaagacacggtgcaaatccatgatatcactgggaaagattgtcaagacattgccaataagggagctaaacagagcgggctttactttattaaacctctgaaagctaaccagcaattcttagtctactgtgaaatcgatgggtctggaaatggatggactgtgtttcagaagagacttgatggcagtgtagatttcaagaaaaactggattcaatataaagaaggatttggacatctgtctcctactggcacaacagaattttggctgggaaatgagaagattcatttgataagcacacagtctgccatcccatatgcattaagagtggaactggaagactggaatggcagaaccagtactgcagactatgccatgttcaaggtgggacctgaagctgacaagtaccgcctaacatatgcctacttcgctggtggggatgctggagatgcctttgatggctttgattttggcgatgatcctagtgacaagtttttcacatcccataatggcatgcagttcagtacctgggacaatgacaatgataagtttgaaggcaactgtgctgaacaggatggatctggttggtggatgaacaagtgtcacgctggccatctcaatggagtttattaccaaggtggcacttactcaaaagcatctactcctaatggttatgataatggcattatttgggccacttggaaaacccggtggtattccatgaagaaaaccactatgaagataatcccattcaacagactcacaattggagaaggacagcaacaccacctggggggagccaaacaggctggagacgtttaa
Protein Sequence	MSWSLHPRNLILYFYALLFLSSTCVAYVATRDNCCILDERFGSYCPTTCGIADFLSTYQTKVDKDLQSLEDILHQVENKTSEVKQLIKAIQLTYNPDESSKPNMIDAATLKSRKMLEEIMKYEASILTHDSSIRYLQEIYNSNNQKIVNLKEKVAQLEAQCQEPCKDTVQIHDITGKDCQDIANKGAKQSGLYFIKPLKANQQFLVYCEIDGSGNGWTVFQKRLDGSVDFKKNWIQYKEGFGHLSPTGTTEFWLGNEKIHLISTQSAIPYALRVELEDWNGRTSTADYAMFKVGPEADKYRLTYAYFAGGDAGDAFDGFDFGDDPSDKFFTSHNGMQFSTWDNDNDKFEGNCAEQDGSGWWMNKCHAGHLNGVYYQGGTYSKASTPNGYDNGIIWATWKTRWYSMKKTTMKIIPFNRLTIGEGQQHHLGGAKQAGDV
Functional Site/Region	Site at 68-68, phosphorylation, seq=S; Site at 78-78, glycosylation, seq=N; Site at 84-85, cleavage, seq=KQ; Site at 88-89, cleavage, seq=KA; Site at 102-103, cleavage, seq=PN; Site at 334-334, glycosylation, seq=N; Region at 400-422, Gamma-chain polymerization; binding amino, seq=TRWYSMKKTTMKIIPFNRLTIGE;

Serotype	Targeting Tissues
1	Central Nervous System, Heart, Retinal Pigment Epithelium, Skeletal Muscle
2	Central Nervous System, Kidney, Photoreceptor Cells, Retinal Pigment Epithelium
5	Central Nervous System, Lung, Photoreceptor Cells, Retinal Pigment Epithelium
7	Liver, Skeletal Muscle
8	Central Nervous System, Heart, Liver, Pancreas, Photoreceptor Cells, Retinal Pigment Epithelium
9	Central Nervous System, Heart, Liver, Lung, Skeletal Muscle
RH10	Central Nervous System, Liver, Skeletal Muscle, Lung

User Instructions | pCT-AAV-CMV-ORF Vector Map | Materials Safety Data Sheet

Catalog Number	Product	Size	Price	Qty
ET-100288-AAV-1-50	FGG rAAV Virus Particles (Serotype 1)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-100288-AAV-1-200	FGG rAAV Virus Particles (Serotype 1)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-100288-AAV-2-50	FGG rAAV Virus Particles (Serotype 2)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-100288-AAV-2-200	FGG rAAV Virus Particles (Serotype 2)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-100288-AAV-5-50	FGG rAAV Virus Particles (Serotype 5)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-100288-AAV-5-200	FGG rAAV Virus Particles (Serotype 5)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-100288-AAV-7-50	FGG rAAV Virus Particles (Serotype 7)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-100288-AAV-7-200	FGG rAAV Virus Particles (Serotype 7)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-100288-AAV-8-50	FGG rAAV Virus Particles (Serotype 8)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-100288-AAV-8-200	FGG rAAV Virus Particles (Serotype 8)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-100288-AAV-9-50	FGG rAAV Virus Particles (Serotype 9)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-100288-AAV-9-200	FGG rAAV Virus Particles (Serotype 9)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-100288-AAV-RH10-50	FGG rAAV Virus Particles (Serotype RH10)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-100288-AAV-RH10-200	FGG rAAV Virus Particles (Serotype RH10)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-100288-AAV-pd	FGG pAAV-CMV-ORF TRANSFER VECTOR (Plasmid), Glycerol Stock	1 vial	Price: $1,200.00	Quantity

Products

Services

Products

Services

FGG Full-Length ORF: Human Gene AAV Virus

Shopping Cart: 0 Items

Your Wishlist: 0 Items