GP5 ORF clone

Description: Human platelet glycoprotein V (GP5) is a part of the Ib-V-IX system of surface glycoproteins that constitute the receptor for von Willebrand factor (VWF; MIM 613160) and mediate the adhesion of platelets to injured vascular surfaces in the arterial circulation, a critical initiating event in hemostasis. The main portion of the receptor is a heterodimer composed of 2 polypeptide chains, an alpha chain (GP1BA; MIM 606672) and a beta chain (GP1BB; MIM 138720), that are linked by disulfide bonds. The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX (GP9; MIM 173515) and GP5. Mutations in GP1BA, GP1BB, and GP9 have been shown to cause Bernard-Soulier syndrome (MIM 231200), a bleeding disorder (review by Lopez et al., 1998 [PubMed 9616133]).[supplied by OMIM, Nov 2010].

This ORF sequence encodes a protein that is exactly the same as the protein of NM_004488. The protein has 23 functional sites and/or regions.

Product Details

Clone Vector	pCT-AAV-CMV-MCS vector
Species	Human
Promotor for Target Gene	CMV
Target Gene Name	GP5
Target Gene Position	Inserted between PacI and AscI
ORF Length	1680
Protein Length	560
Native Stop Codon	False
ORF Sequence	atgctgagggggactctactgtgcgcggtgctcgggcttctgcgcgcccagcccttcccctgtccgccagcttgcaagtgtgtcttccgggacgccgcgcagtgctcggggggcgacgtggcgcgcatctccgcgctaggcctgcccaccaacctcacgcacatcctgctcttcggaatgggccgcggcgtcctgcagagccagagcttcagcggcatgaccgtcctgcagcgcctcatgatctccgacagccacatttccgccgttgcccccggcaccttcagtgacctgataaaactgaaaaccctgaggctgtcgcgcaacaaaatcacgcatcttccaggtgcgctgctggataagatggtgctcctggagcagttgtttttggaccacaatgcgctaaggggcattgaccaaaacatgtttcagaaactggttaacctgcaggagctcgctctgaaccagaatcagctcgatttccttcctgccagtctcttcacgaatctggagaacctgaagttgttggatttatcgggaaacaacctgacccacctgcccaaggggttgcttggagcacaggctaagctcgagagacttctgctccactcgaaccgccttgtgtctctggattcggggctgttgaacagcctgggcgccctgacggagctgcagttccaccgaaatcacatccgttccatcgcacccggggccttcgaccggctcccaaacctcagttctttgacgctttcgagaaaccaccttgcgtttctcccctctgcgctctttcttcattcgcacaatctgactctgttgactctgttcgagaacccgctggcagagctcccgggggtgctcttcggggagatggggggcctgcaggagctgtggctgaaccgcacccagctgcgcaccctgcccgccgccgccttccgcaacctgagccgcctgcggtacttaggggtgactctgagcccgcggctgagcgcgcttccgcagggcgccttccagggccttggcgagctccaggtgctcgccctgcactccaacggcctgaccgccctccccgacggcttgctgcgcggcctcggcaagctgcgccaggtgtccctgcgccgcaacaggctgcgcgccctgccccgtgccctcttccgcaatctcagcagcctggagagcgtccagctcgaccacaaccagctggagaccctgcctggcgacgtgtttggggctctgccccggctgacggaggtcctgttggggcacaactcctggcgctgcgactgtggcctggggcccttcctggggtggctgcggcagcacctaggcctcgtgggcggggaagagcccccacggtgcgcaggccctggggcgcacgccggcctgccgctctgggccctgccggggggtgacgcggagtgcccgggcccccggggcccgcctccccgccccgctgcggacagctcctcggaagcccctgtccacccagccttggctcccaacagctcagaaccctgggtgtgggcccagccggtgaccacgggcaaaggtcaagatcatagtccgttctgggggttttattttctgcttttagctgttcaggccatgatcaccgtgatcatcgtgtttgctatgattaaaattggccaactctttcgaaaattaatcagagagagagcccttggg
Protein Sequence	MLRGTLLCAVLGLLRAQPFPCPPACKCVFRDAAQCSGGDVARISALGLPTNLTHILLFGMGRGVLQSQSFSGMTVLQRLMISDSHISAVAPGTFSDLIKLKTLRLSRNKITHLPGALLDKMVLLEQLFLDHNALRGIDQNMFQKLVNLQELALNQNQLDFLPASLFTNLENLKLLDLSGNNLTHLPKGLLGAQAKLERLLLHSNRLVSLDSGLLNSLGALTELQFHRNHIRSIAPGAFDRLPNLSSLTLSRNHLAFLPSALFLHSHNLTLLTLFENPLAELPGVLFGEMGGLQELWLNRTQLRTLPAAAFRNLSRLRYLGVTLSPRLSALPQGAFQGLGELQVLALHSNGLTALPDGLLRGLGKLRQVSLRRNRLRALPRALFRNLSSLESVQLDHNQLETLPGDVFGALPRLTEVLLGHNSWRCDCGLGPFLGWLRQHLGLVGGEEPPRCAGPGAHAGLPLWALPGGDAECPGPRGPPPRPAADSSSEAPVHPALAPNSSEPWVWAQPVTTGKGQDHSPFWGFYFLLLAVQAMITVIIVFAMIKIGQLFRKLIRERALG
Functional Site/Region	Site at 51-51, glycosylation, seq=N; Region at 75-96, LRR 1, seq=VLQRLMISDSHISAVAPGTFSD; Region at 99-120, LRR 2, seq=KLKTLRLSRNKITHLPGALLDK; Region at 123-144, LRR 3, seq=LLEQLFLDHNALRGIDQNMFQK; Region at 147-168, LRR 4, seq=NLQELALNQNQLDFLPASLFTN; Region at 171-193, LRR 5, seq=NLKLLDLSGNNLTHLPKGLLGAQ; Site at 181-181, glycosylation, seq=N; Region at 195-216, LRR 6, seq=KLERLLLHSNRLVSLDSGLLNS; Region at 219-240, LRR 7, seq=ALTELQFHRNHIRSIAPGAFDR; Region at 243-264, LRR 8, seq=NLSSLTLSRNHLAFLPSALFLH; Site at 243-243, glycosylation, seq=N; Region at 267-288, LRR 9, seq=NLTLLTLFENPLAELPGVLFGE; Site at 267-267, glycosylation, seq=N; Region at 291-312, LRR 10, seq=GLQELWLNRTQLRTLPAAAFRN; Site at 298-298, glycosylation, seq=N; Site at 312-312, glycosylation, seq=N; Region at 340-361, LRR 11, seq=ELQVLALHSNGLTALPDGLLRG; Region at 364-385, LRR 12, seq=KLRQVSLRRNRLRALPRALFRN; Site at 385-385, glycosylation, seq=N; Region at 388-409, LRR 13, seq=SLESVQLDHNQLETLPGDVFGA; Region at 469-498, Disordered., seq=DAECPGPRGPPPRPAADSSSEAPVHPALAP; Site at 499-499, glycosylation, seq=N; Site at 524-544, transmembrane region, seq=FYFLLLAVQAMITVIIVFAMI;

Serotype	Targeting Tissues
1	Central Nervous System, Heart, Retinal Pigment Epithelium, Skeletal Muscle
2	Central Nervous System, Kidney, Photoreceptor Cells, Retinal Pigment Epithelium
5	Central Nervous System, Lung, Photoreceptor Cells, Retinal Pigment Epithelium
7	Liver, Skeletal Muscle
8	Central Nervous System, Heart, Liver, Pancreas, Photoreceptor Cells, Retinal Pigment Epithelium
9	Central Nervous System, Heart, Liver, Lung, Skeletal Muscle
RH10	Central Nervous System, Liver, Skeletal Muscle, Lung

User Instructions | pCT-AAV-CMV-ORF Vector Map | Materials Safety Data Sheet

Catalog Number	Product	Size	Price	Qty
ET-108764-AAV-1-50	GP5 rAAV Virus Particles (Serotype 1)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-108764-AAV-1-200	GP5 rAAV Virus Particles (Serotype 1)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-108764-AAV-2-50	GP5 rAAV Virus Particles (Serotype 2)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-108764-AAV-2-200	GP5 rAAV Virus Particles (Serotype 2)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-108764-AAV-5-50	GP5 rAAV Virus Particles (Serotype 5)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-108764-AAV-5-200	GP5 rAAV Virus Particles (Serotype 5)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-108764-AAV-7-50	GP5 rAAV Virus Particles (Serotype 7)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-108764-AAV-7-200	GP5 rAAV Virus Particles (Serotype 7)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-108764-AAV-8-50	GP5 rAAV Virus Particles (Serotype 8)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-108764-AAV-8-200	GP5 rAAV Virus Particles (Serotype 8)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-108764-AAV-9-50	GP5 rAAV Virus Particles (Serotype 9)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-108764-AAV-9-200	GP5 rAAV Virus Particles (Serotype 9)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-108764-AAV-RH10-50	GP5 rAAV Virus Particles (Serotype RH10)	2x25 ul per vial, 1x10^12 gc/ml	Price: $700.00	Quantity
ET-108764-AAV-RH10-200	GP5 rAAV Virus Particles (Serotype RH10)	8x25 ul per vial, 1x10^12 gc/ml	Price: $1,200.00	Quantity
ET-108764-AAV-pd	GP5 pAAV-CMV-ORF TRANSFER VECTOR (Plasmid), Glycerol Stock	1 vial	Price: $1,200.00	Quantity

Products

Services

Products

Services

GP5 Full-Length ORF: Human Gene AAV Virus

Shopping Cart: 0 Items

Your Wishlist: 0 Items